Join us   Log in   editor@ijrdpl.com  



IJRDPL - Vol 7, Issue 1 (2018), January - February

Pages: 2896-2900

Date of Publication: 15-Jan-2018


Print Article   Download XML  Download PDF

Genetic analysis of MTR and MTRR gene polymorphisms in healthy mothers from Eastern part of India

Author: SusantaSadhukhan1, Silpita Paul1, BiswabandhuBankura1, Dinesh Munian2, Sudakshina Ghosh1 and Madhusudan Das*1

Category: Pharmaceutical Sciences

Abstract:

The polymorphic variation of MTR and MTRR genes can influence the folate metabolism and homeocysteineremethylation processes and consequently has strong impact on Neural Tube Defects (NTD). The SNP of MTR and MTRR genes has been reported in some populations, but in the Indian population has never been explored. This study is focused on the frequency distributions of rs1805087 (D919G/A2756G) and rs1801394 (I22M/A66G) of these genes in the West Bengal population, India for the first time. The G allele frequencies of rs1085087 and rs1801394 were 8% and 47% respectively. The G allele frequency of MTR rs1085087 in Indian population is less than the other major population; such as, in European (17%), American (18%), African (28%) and South Asian (32%) population. The G allele frequency of MTRR rs1801394 is quite like the European and south Asian population (G=52%) but greatly differs from African (25%), East Asian (26%) and mixed American (28%) population. This observation might help us to understand pattern of genetic alteration and development of single screening protocol for early detection and better prognosis in future.

Keywords: Methionine Synthase (MTR), Methionine Synthase Reductase (MTRR), Single Nucleotide Polymorphism (SNP), Allele

DOI: 10.21276/IJRDPL

DOI URL: http://dx.doi.org/10.21276/IJRDPL.2278-0238.2018.7(1).2896-2900

Full Text:

The second most common complicated and multifactorial congenital malformation of central nervous system is Neural Tube Defects (NTD) [25, 28]. According to 2012 WHO report, three lakh babies were affected per year worldwide by NTD. The acquired or inherited pattern of NTD is strongly guided by both genetic and environmental factors which acted throughout the period of development of the foetus [17, 19].

Most of the studies reported that 1-28 days of gestational period is the crucial time for development of NTD during pregnancy. The incident rate of NTD is 1-2 per 1000 live birth worldwide [21,24] and in India is 2.41-4.1per 1000 live birth [2, 13].In India the prevalence is higher in northern India (11 per 1000 birth) compare to southern India (5 per 1000 birth) [8].

Folic acid deficiency and defected methionine metabolism are two most reported cause for NTD development, which can be determined by high homocysteine levels during pregnancy [4].Although peri-conceptional uptake of folic acid reduces the risk of NTDs by 50–70% [26].The folate –homoecysteine metabolic pathway is controlled by several enzymes like MTHFR, DHFR, MTRR, MTR etc [10].

The MTR and MTRR gene is responsible for the conversion of homocysteine to methionine infolate-homeocystine metabolism pathway [4, 14]. The circulating form of folate in blood is 5-Methyltetrahydrofolate (5-methylTHF), which donate its methyl group to homocysteine, via the cofactor cob(I)alamin by the help of methionine synthase (MTR) enzyme. This Cob (I) alamin oxidized to cob(II)alamin which inactivates the cobalamin–MTR–enzyme complex.

Methionine synthase reductase (MTRR) induced MTR activity by reductive methylation cob (II)alamin.Methionine amino acid plays an important role in protein synthesis and one-carbon metabolism and the synthesis of Methionine guided by enzyme methionine synthase. Reductive methylation of cobalamin by the enzyme MTR reductase (MTRR, EC 2.1.1.135) regenerates inactive MTR [5]. Normal functioning of MTR adversely affected by deficiency MTRR result in increased homocysteine levels and also methylation processes. Vitamin B12-dependent enzyme MTR (EC 2.1.1.13) controls the homocysteine levels and folate pools within a cell by the remethylation of homocysteine to methionine. Chromosomal location of human MTR gene 1q43 produces 1265 amino acid long polypeptide chain whose molecular weight is approximately 140.5 kDa. The nucleotide changes of MTR gene (MTR A2756G; rs1805087) have a great impact on the amino acid aspartic acid that changes into glycine (D919G). Most of the studies have reported that this A2756G polymorphism works as a risk factor for the development of NTD [1, 6, 7, 15, 18, 27, 29].

MTRR classified as the member of the ferredoxin NADP (+) reductase (FNR) family of electron transferases. Chromosomal location of human MTRR gene is 5p15.2-15.3.the nucleotide change of MTRR gene A66G (rs1801394) have an impact on the amino acid change isoleucine to methionine (I22M). Most of the studies have been reported that this polymorphism increases the risk for NTDs [18, 20, 22, 26, 29].

As stated above, rs1805087 and rs1801394 play significant role in NTDs. Aside, NTDs, we want to observe the normal distribution of these SNPs in healthy mothers, so later we can draw a rational correlation with the case population. In West Bengal, there is no report of allelic spectrum of these particular rs1805087 of MTR gene and rs1801394 of MTRR gene. Our study first time aimed to identify the frequency distributions of Genotypic as well as allelic of rs1805087 and rs1801394 in healthy Bengali mothers of residence of West Bengal, India.

METHODOLOGY

Collection of samples

In the present study 50 unrelated healthy mothers were identified and enrolled who were visiting the Department of Neonatology, Institute of Post Graduate Medical Education and Research (IPGME&R), SSKM Kolkata. They were selected by checking several parameters like socio-economic status, occupation, previous history of diabetes, neural disease or any other birth defects, age, body mass index (BMI), smoking habits, alcohol drinking by physical examination and personal interrogation for each of the individuals. The study has been started after achieving the ethical clearance from Ethical Committee of IPGME&R, SSKM Kolkata. Written informed consent was obtained from all adult participants included in this study [Memo No. Inst/IEC/2015/43]. Samples were then analyzed by isolating the Genomic DNA using QIAamp Blood Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. After the isolation, the concentrations and purity of DNA was measured in each sample using Nano-photometer light absorbance at 260 and 280 nm.

Subject exclusion criteria:

  1. Babies with meningomyelocele, meningocele, encephalocele, anencephaly disorder.
  2. Pregnant women with low folate and Hcy level.
  3. Mothers with pre-existing medical disease (diabetes) [24]

Subject inclusion criteria:

  1. All normal pregnant women.

Genotyping

Polymerase chain reactions (PCR) was done by using following PCR mixture and cycling program in Thermocyclerfor standardizing specific exon containing mentioned SNPs. The 25 ????Lofreaction mixture contained 40–100 ng of genomic DNA, 1.5mM MgCl2, 100????M of each dNTP, 0.4????M of each primer, and 0.5 unit of Taq DNA polymerase (Applied Biosystems). The cycling program is maintained by denaturation at 95?C for 30 seconds, annealing at 58?C (for MTR) and 60?C (for MTRR) for 30 seconds, and extension at 72?C for 30 seconds were performed and these whole steps were repeated for 42 cycles. The conformation of the PCR product size was done by preparing 1.5% agarose gel followed by electrophoresis. PCR fragments would be checked and purified from agarose gel using QIAEX II (Qiagen, Hilden, Germany). Finally, the PCR products were subjected to direct sequencing to identify SNPs. Direct sequencing would be performed using Taq Dye Deoxy Terminator sequencing kit Applied Biosystems, City, USA with an ABI Prism 377 DNA Sequencer (PE Applied Biosystems). Pair wise sequence alignments were performed to find the best-matching piecewise (local) or global alignments of two query sequences using clustalW program both in database and controls. These following primers set were used during the PCR reaction (Table 1).

Table 1: Set of Primers for MTR and MTRR

rs1805087

MTR F

5'CAGTGTTCCCAGCTGTTAGAT3'

MTR R

5'AGACACTGAAGACCTCTGATTTG3'

rs1801394

MTRR F

5’CAAGTAGTTTCGAGCCGATCAT3’

MTRR R

5’GCTGGTGATATCTTACTATACCATTGA3’

Statistical analysis

The genotype and allele frequencies were determined by using GraphpadInstat 3 software and the genotype data analyzed by using Chi-square test. The comparison between observedand expected frequencies was done and tested the population for Hardy-Weinberg equilibrium. Furthermore, allele frequencies differences between West Bengal and other ethnic populations has been measured by using 1000 genome project. Haploview software (version 4.1. A) has-been used for the calculation of Linkage disequilibrium (LD) where P-value <0.05 was considered as statistically significant level.

RESULT

In this study, most of the mothers showed rural inhabitation and few of them are devoted for cultivation purpose where as other are housewives and most of them are aged bellow 30. The details of the study population were mentioned in the Table 2.

The genetic study revealed that, 8 individuals (16.0%) were found heterozygous (A/G) carriers and 42 individuals (84.0%) with homozygous wild type (A/A) allele for rs1805087. We did not find any homozygous G/G genotype in the studied population regarding this polymorphism. The allele frequency for A is 92% and G is 8% for the rs1805087(Table 3).The G allele frequency in West Bengal population (8%) shows a similar pattern with East Asia population (11%) but greatly differs from the other major populations; such as, European (17%), American (18%), African (28%) and South Asian (32%) populations.The genotype frequencies of rs1801394 homozygote wild type (A/A), heterozygote (A/G) and homozygote variant (G/G) were 30.0%, 46.0% and 24.0% respectively for MTRR gene(Table 3).The allele frequency for the A allele is 53% and 47% for the G allele, which isquite similar to the European and south Asian population (G=52%) but greatly differs from African (25%) East Asian (26%) and mixed American (28%) population.The studied polymorphisms were in Hardy-Weinberg equilibrium.

Table 2: Epidemiological Data: Socio-economic characters of study participants (mothers) [n=total no of healthy mother]

Epidemiological parameter

Number-50 (n %)

Location

Rural

32(64)

Urban

18(36)

Age

Bellow 30

43(86)

Above30

7(14)

Education

Bellow 8th Standard

8(16)

8th pass

14(28)

10th pass

17(34)

12th pass

8(16)

Graduation

3(6)

Smoking habit

0(0)

Drinking habit

0(0)

Oral tobacco

0(0)

Occupation

Working

2(4)

Housewife

48(96)

Table 3: Genotype and allele frequencies of MTR and MTRR genes obtained in the study population

Polymorphism

Genotype frequency %

Allele frequency %

MTR (n=50)

AA

AG

GG

A

G

rs1805087

(2756 A> G)

84

16

0

92.0

8.0

MTRR(n=50)

rs1801394

(66 A >G)

30

46

24

53.0

47.0

DISCUSSION

Polymorphism of genes leading to inter-individual genetic difference which can be translated in to abnormal folate metabolism considered to be an important cause for development of NTD. The polymorphisms in folate metabolism pathway genes and folate carrier genes also play crucial role in methylation process and several human congenital defects of central nervous system. Thus, we carried out a screening program in the population of West Bengal, India to find out the distribution of some specific SNPs that was reported earlier as a probable cause of NTD.

It is reported that A2756G (rs1805087) polymorphism of MTR gene is considered as a risk factor for spina bifida in the American population [7] and in some other population as well [9, 11]. In the Jordan population, association of AG genotype is frequently observed in mothers with NTD-affected children compared to AA genotype [1]. But in our study, AG genotype is present in 16% of control mother, while most of the mothers show the AA genotype (84%). European and Hispanic–American populations strongly claimed that A2756G polymorphism induces the risk for NTDs [6, 7, 10, 12, 18, 29]. On the other hand, UK and Netherlands populations did not show any association between the polymorphism and risk of NTD [27, 16].

Our result showed that the MAF for MTR; rs1805087 (A2756G) is 8 % where as in other population like white European, Irish, American Caucasians and African Americans shows that MAF is 21%,20%,17%,22% respectively, which are quite higher frequencies than our study [18, 22] (Table 4). In contrast the data obtained from the 1000 genome project shows that African, Mixed American European and South Asian have the MAF 28%, 18% 17%, 32%, respectively. (Table 5) This difference reflects a change in population origin. The individuals included in our study population belong to mixed ethnic background-Indo European and Austro Asiatic [3]. This might be the probable reason for the altered frequency of MTR; rs1805087 (A2756G) polymorphism in our study.

Several studies indicated that MTRR A66G polymorphism is strongly associated with NTD, whereas few studies from different population have failed to establish this association between A2756G polymorphism with NTD. Van der Linden, 2006, have found the association of NTDs with MTRR-A66G polymorphism in Caucasians population while Wilson et al, 1999 reported that Low vitamin B12 levels with MTRR-A66G polymorphism increases NTDsrisk.

Some studies reported that 1.9-fold to 3.1-fold increased risk for spina bifida conducted by A66G homozygous genotype [20, 26, 29].On the contrary, in Irish and Indian populations, the A66G polymorphism was not associated with susceptible risk for NTDs [15].

Our results basically show the distribution of these SNPs in healthy mothers of West Bengal.In our control population, we got 46% bearing the AG allele, whereas 24% bear GG allele for A66G polymorphism.The A66G polymorphism (rs1801394) of MTRR in our healthy mother group shows the MAF 47%, which lies in between American Caucasians population and European (45%and 51%),Whereas moderately differ with white European (40%) and also greatly differ from African American (67%) population [25,18] (Table 4).Similarly when our study group compare with the others world population’s data obtained from 1000 genome projects it has been found that MAF greatly differ with African, Mixed American, East Asian(25%, 28%, 26%) population but shows a pretty similar with European (52%) and South Asian (52%)(Table 5).This deviation in MAF with other populations to our studied group may be due to their different genetic hierarchy and ancestral pattern with different genetic composition as well as different ethnicity.

Table 4: Genotype and allele frequencies of MTRR and MTR polymorphisms in white European, Irish controls, American-Caucasians, and African-Americans [18, 20]

Population Name

n

Genotype Frequency (%)

Allele Frequency (%)

AA

AG

GG

A

G

MTR (A2756G)

rs1805087

Present study

50

84

16

0

92.0

8.0

White European

188

63

32

5

79

21

Irish controls

487

64

32

04

80

20

American-Caucasians

89

70

27

03

83

17

African-Americans

95

60

37

3

78

22

MTRR (A66G)

rs1801394

Present study

30

46

24

53.0

47.0

White European

184

22

54

24

49

51

Irish controls

476

37

47

16

60

40

American-Caucasians

91

32

47

21

55

45

African-Americans

96

11

44

45

33

67

According to Zhu et al. 2003, MTR A2756G polymorphism alone has no serious impact in formation of NTD but combined with MTRR A66G, it yielded NTD strongly as MTRR is the only responsible enzyme for the activation of MTR.In a line, van der Linden et alreported that, mothers with both the MTRR 66 GG and MTR 2756GG/AG genotypes had a 3 fold increased risk of spina bifida child, compared to 66AA/AG and 2756AA genotype [26].However, our results revealed that, only 1 mother carrying MTRR 66GG + MTR 2756AG but not a single mother was found to carryMTRR 66 GG + MTR 2756GG genotype. This is probably; we included only normal individuals in our study.

Table 5: Allele frequencies of MTRR and MTR polymorphisms in other major population [30]

Population Name

n

Allele Frequency (%)

A

G

MTR (rs1805087)

Present study

50

92

8

African

661

72

28

Mixed American

347

82

18

East Asian

504

89

11

European

503

83

17

South Asian

489

68

32

Bengali in Bangladesh

86

67

33

MTRR (rs1801394)

Present study

50

53

47

African

661

75

25

Mixed American

347

72

28

East Asian

504

74

26

European

503

48

52

South Asian

489

48

52

Bengali In Bangladesh

86

47

53

To the best of our knowledge, this is the first study reported from eastern part of India that mapped the allele and genotype frequency distribution ofrs1805087 (D919G/A2756G) and rs1801394 (I22M/A66G).Hence, our study can function as a platform for future studies to evaluate the association of NTD with these variants in MTR and MTRR genes in ethnically distinct East Indian population.

ACKNOWLEDGEMENTS

The work was supported by the Department of West Bengal State Council of Science & Technology.

Conflicts of interest: None

References:

  1. Alfarra H Y. Methionine synthase polymorphisms (MTR 2756 A>G and MTR 2758 C>G) frequencies and distribution in the Jordanian population and their correlation with neural tube defects in the population of the northern part of Jordan. Indian J Hum Genet. 2010;16(3): 138-43. doi: 10.4103/0971-6866.73405.
  2. Allagh PK, Shamanna RB, Murthy VSG, Ness RA, Doyle P, Neogi BS, Pant BH. Birth Prevalence of Neural Tube Defects and Orofacial Clefts in India. A Systematic Review and Meta-Analysis. 2015;https://doi.org/10.1371/journal.pone.0118961.
  3. Basu A, Mukherjee N, Roy S, Sengupta S, Banerjee S, Chakraborty M, Dey B, Roy M,Roy B. Bhattacharyya NP, Roychoudhury S, MajumderPP.Ethnic India: agenomic view, with special reference to peopling and structure. Genome Res. 2003; 13(10): 2277–2290.
  4. Cheng H, Li H Bu, Z Zhang, Q Bai B, Zhao H, Ren-Ke L, Zhang T,Xie J. Functional variant in methionine synthase reductase intron-1 is associated with pleiotropic congenital malformations. Mol Cell Biochem .2015; 407: 51–56, DOI 10.1007/s11010-015-2453-8
  5. Chen LH, et al.Human methionine synthase. cDNA cloning, gene localization, and expression. J. Biol. Chem. 1997; 272, 3628–3634.
  6. Candito M, Rivet R, Herbeth B, et al.. Nutritional and genetic determinants of vitamin B and homocysteine metabolisms in neural tube defects: a multicenter case-control study.Am J Med Genet 2008; A.146A(9), 1128-1133. doi: 10.1002/ajmg.a.32199.
  7. Doolin MT, Barbaux S, McDonnell M, Hoess K, Whitehead AS, Mitchell LE. Maternal genetic effects, exerted by genes involved in homocysteinere methylation, influence the risk of spinabifida.Am J Hum Genet.2002;71(5):1222-1226.
  8. Dalal A, Pradhan M, Tiwari D, Behari S, Singh U, Mallik GK, Das V, Agarwal S. MTHFR 677C-->T and 1298A-->C polymorphisms: evaluation of maternal genotypic risk and association with level of neural tube defect. GynecolObstetInvestig. 2007;63: 146-150.
  9. Doudney K, Grinham J, Whittaker J, Lynch SA, Thompson D, Moore GE, Copp AJ, Greene ND, Stanier P. Evaluation of folate metabolism gene polymorphisms as risk factors for open and closed neural tube defects. Am J Med Genet A. 2009; 149A (7): 1585–1589.
  10. De Marco P, Calevo MG, Moroni A, et al. Study of MTHFR and MS polymorphisms as risk factors for NTD in the Italian population, J Hum Genet. 2002;47: 319-324
  11. Guçant-Rodriguez RM, Rendeli C, Namour B, Venuti L, Romano A, Anello G, Bosco P, Debard R, Gçrard P, Viola M, Salvaggio E, Guçant JL. Transcobalamin and methionine synthase reductasemutated polymorphisms aggravate the risk of neural tubedefects in humans. NeurosciLett.2003; 344(3):189-192.
  12. Johanning GL, Tamura T, Johnston KE, Wenstrom KD. Comorbidity of 5,10-methylenetetrahydrofolate reductase and methionine synthase gene polymorphisms and risk for neural tube defects.J Med Genet.2000; 37: 949–951.
  13. Kant S, Malhotra S, Singh KA., Haldar P, Kaur R, Misra P, Gupta N. Prevalence of Neural Tube Defects in a Rural Area of North India from 2001 to 2014: A Population-Based Survey. Birth DefectsRes. 2017; 109 (3): 203-210.
  14. Leary VBO, Mills JL, Pangilinan F, Kirke PN, Cox C, Conley M, Weiler A, Peng K, Shane B,Scott JM, Parle-McDermott A, Molloy AM, Brody LC.Analysis of methionine synthase reductase polymorphisms for neural tube defects risk association.Molecular Genetics and Metabolism.2005; 85: 220–227, doi:10.1016/j.ymgme.2005.02.003
  15. Lucock M, Daskalakis I, Briggs D, Yates Z, LeveneM.AlteredFolate Metabolism and Disposition in Mothers Affected by a Spina Bifida Pregnancy: Influence of 677c --? T MethylenetetrahydrofolateReductase and 2756a --? G Methionine Synthase Genotypes. M Lucocket al. Mol Genet Metab.2000;70 (1): 27-44.
  16. Morrison K, Papapetrou C, Hol FA, etal.Susceptibility to spina bifida: an association study of five candidate genes. Ann Hum Genet. 1998; 62: 379–396.
  17. National Center on Birth Defects and OevPlopmental Disabilities Promoting the health of babies, children, and adults and enhancing the potential for full, productive living. Annual Report, Fiscal, 2012.
  18. O’Leary BV, Mills JL,Pangilinan F, Kirke PN, Cox C, Conley M, WeilerA,Peng K, Shane B, Scott JM, McDermott AP, Molloy AM, awrence Brody LC. Analysis of methionine synthase reductase polymorphisms for neural tube defects risk association. Mol Genet Metab. 2005; 85(3):220-227.
  19. Ouyang S, Li Y, Liu Z, Chang H, Wu J..Meta-analyses on the association of MTR A2756G and MTRR A66G polymorphisms with neural tube defect risks in Caucasian children. J Matern Fetal Neonatal Med, 2013;26(12): 1166–1170, Doi: 10.3109/14767058.2013.777699
  20. Pietrzyk JJ, Bik-Multanowski M, Sanak M, TwardowskaM.Polymorphisms of the 5,10-methylenetetrahydrofolate and the methionine synthase reductase genes as independent risk factors for spina bifida. Journal of Applied Genetics.2003;44: 111–113.
  21. Pappa L, Kals M, Kivistik AP, Metspalu A, Paal A. Nikopensius T. Exome analysis in an Estonian multiplex family with neural tube defects—a case report.2017; 10(3). Doi 10.1007/s00381-017-3491-1.
  22. Relton CL, Wilding CS, Laffling AJ, Jonas, PA, Burgess T, Binks K, Tawn EJ, Burn J. Low erythrocyte folate status and polymorphic variation in folate related genes are associated with risk of neural tube defect pregnancy. Mol Genet Metab.2004; 81: 273– 281.
  23. Sharma AK, Upreti M, Kamboj M, Mewhra P, Das K, Mura A,Dhasmana S, Agarwal SS. Incidence of neural tube defects at Lucknow over a 10 year period from 1982–1991. Indian J Med Res. 1994;99: 223–226.
  24. Salbaum JM, Kappen C. Neural tube defect genes and maternal diabetes during pregnancy. Birth Defects Res A ClinMolTeratol. 2010; 88(8): 601-611.doi:10.1002/bdra.20680.
  25. Van der Linden IJM, Den Heijer M,Afman LA, Gellekink H, Vermeulen SHHM, Leo AJ, Kluijtmans, BlomHJ.The methionine synthase reductase 66A>G polymorphism is a maternal risk factor for spinabifida.Springer-Verlag .J Mol Med.2006; 84: 1047–1054. DOI 10.1007/s00109-006-0093-x
  26. Van der Linden IJ, Afman LA, Heil SG, Blom HJ.Genetic variation in genes of folate metabolism and neural-tube defect risk. ProcNutr Soc. 2006; 65(2): 204-215.
  27. Van der Put NM, Gabreels F, Stevens EM, et al. A second common mutation in the methylenetetrahydrofolatereductase gene: An additional risk factor for neural-tube defects? Am J Hum Genet. 1998; 62: 1044–1051.
  28. Wang BJ, Liu MJ, Wang Y, Dai JR., Tao JY, Wang SN, Zhong N, Chen Y. Association between SNPs in genes involved in folate metabolism and preterm birth risk. Genet Mol Res.2015; 14(1): 850-859. doi: 10.4238/2015.February.2.9.
  29. Zhu H, Wicker NJ, Shaw GM, Lammer EJ, Hendricks K, Suarez L, Canfield M, Finnell RH.Homocysteineremethylation enzyme polymorphisms and increased risks for neural tube defects. Molecular Genetics and Metabolism.2003; 78:216–221.doi:10.1016/S1096-7192(03)00008-8.
  30. 1000 genome project (https://www.ncbi.nlm.nih.gov › NCBI › Variation › Tools)